View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16879_low_8 (Length: 222)

Name: NF16879_low_8
Description: NF16879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16879_low_8
NF16879_low_8
[»] chr8 (2 HSPs)
chr8 (22-212)||(44635866-44636056)
chr8 (25-212)||(44624620-44624807)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 212
Target Start/End: Original strand, 44635866 - 44636056
Alignment:
Q  22 gctatgcctgcagtgaggatgacggaagaggcgacattggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataa 121  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44635866 gctatgcctgcagtgaggatgacggaagaggcaacattggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataa 44635965  T
Q  122 tgatgtcacggactatgtcaccggcggtgaaatgctcctcggtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtg 212  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44635966 tgatgtcacggactatgtcaccggcggtgaaatgctcctcagtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtg 44636056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 25 - 212
Target Start/End: Original strand, 44624620 - 44624807
Alignment:
Q  25 atgcctgcagtgaggatgacggaagaggcgacattggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataatga 124  Q
    ||||| |||||||||| || |||||| |   |||||||||||||||||||||| || || ||||| || || ||||| || || ||  | || || ||||    
T  44624620 atgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcggcgagggcgaaagggacggtgaggccatcggaaacgccaatgatga 44624719  T
Q  125 tgtcacggactatgtcaccggcggtgaaatgctcctcggtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtg 212  Q
    |||||||||| || ||||| |||||||| ||||  || ||||||  |||||||||| |||||||||||||||||||| ||||||||||    
T  44624720 tgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaaggctctgtttctcaggttcaaggtttagtctgtg 44624807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University