View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16878_low_9 (Length: 215)

Name: NF16878_low_9
Description: NF16878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16878_low_9
NF16878_low_9
[»] chr1 (1 HSPs)
chr1 (27-199)||(23988248-23988420)
[»] chr5 (1 HSPs)
chr5 (165-199)||(41108246-41108280)
[»] chr4 (1 HSPs)
chr4 (43-81)||(13991095-13991133)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 27 - 199
Target Start/End: Original strand, 23988248 - 23988420
Alignment:
Q  27 atctatagttgaaaacaatcaaattattgagaattcgtgtttttcagaggtggaggacttctatgcaataaatacagcgttgttgcatttggctgctaaa 126  Q
    |||| |||||||||||||  ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23988248 atctgtagttgaaaacaacaaaattattgagaattcgagtttttcggaggtggaggacttctatgcaataaatacagcgttgttgcatttggctgctaaa 23988347  T
Q  127 aaccctattaaaattggagagcttatgactggtggattaggtaccggtggaaatccacttttgggcgaacaag 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23988348 aaccctattaaaattggagagcttatgactggtggattaggtaccggtggaaatccacttttgggcgaacaag 23988420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 199
Target Start/End: Complemental strand, 41108280 - 41108246
Alignment:
Q  165 aggtaccggtggaaatccacttttgggcgaacaag 199  Q
    |||||||||||| ||||||||||||||||||||||    
T  41108280 aggtaccggtgggaatccacttttgggcgaacaag 41108246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 81
Target Start/End: Complemental strand, 13991133 - 13991095
Alignment:
Q  43 aatcaaattattgagaattcgtgtttttcagaggtggag 81  Q
    ||||||||||||||||||||| |||||||| ||||||||    
T  13991133 aatcaaattattgagaattcgagtttttcaaaggtggag 13991095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University