View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1686_high_12 (Length: 227)

Name: NF1686_high_12
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1686_high_12
NF1686_high_12
[»] chr8 (2 HSPs)
chr8 (7-94)||(9394641-9394728)
chr8 (149-227)||(9394506-9394586)


Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 7 - 94
Target Start/End: Complemental strand, 9394728 - 9394641
Alignment:
Q  7 agtctctctttaaaacatagatagagagatatttgaagcaatgatagtccccaatttgagtactctgtgtacttctatcatgtgacct 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||    
T  9394728 agtctctctttaaaacatagatagagagatatttgaagcaatgatagtcccgaatctgagtactctttgtacttctatcatgtgacct 9394641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 149 - 227
Target Start/End: Complemental strand, 9394586 - 9394506
Alignment:
Q  149 acacacgcacatgcacgcacgcgcatactatccgccattaa--aaaacactctgagatggataggagtgcctttatttgta 227  Q
    |||||||||||||||||||| ||||||||||| ||||||||  |||||||| ||||||| |||||||||||||||||||||    
T  9394586 acacacgcacatgcacgcacacgcatactatctgccattaaaaaaaacactttgagatgaataggagtgcctttatttgta 9394506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University