View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16867_low_3 (Length: 229)

Name: NF16867_low_3
Description: NF16867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16867_low_3
NF16867_low_3
[»] chr1 (1 HSPs)
chr1 (15-211)||(6033380-6033576)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 6033380 - 6033576
Alignment:
Q  15 atgaatgaaaagaaaaggaatgagctaatctaaatagaaagaaataacaacattcttcaacaaccaaattaatcatcatgggttcggtagaacgagggaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  6033380 atgaatgaaaagaaaaggaatgagctaatctaaatagaaagaaataacaacgttcttcaacaaccaaattaatcatcatgggttcggtagaacgagggaa 6033479  T
Q  115 gatccattggagcgtatacgacggcgtaaagataatcgctgcaacaccagaagctctgatgtcagaaattgattcagcaatttcgaatctggaatat 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6033480 gatccattggagcgtatacgacggcgtaaagataatcgctgcaacaccagaagctctgatgtcagaaattgattcagcaatttcgaatctggaatat 6033576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University