View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1686-Insertion-5 (Length: 72)

Name: NF1686-Insertion-5
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1686-Insertion-5
NF1686-Insertion-5
[»] chr7 (2 HSPs)
chr7 (8-72)||(4713480-4713544)
chr7 (8-65)||(4854850-4854907)


Alignment Details
Target: chr7 (Bit Score: 65; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 8 - 72
Target Start/End: Original strand, 4713480 - 4713544
Alignment:
Q  8 tatgagtgatgtggttgggactttagagcttgcgttgaaattggttatgagtggggaggatggta 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4713480 tatgagtgatgtggttgggactttagagcttgcgttgaaattggttatgagtggggaggatggta 4713544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 4854850 - 4854907
Alignment:
Q  8 tatgagtgatgtggttgggactttagagcttgcgttgaaattggttatgagtggggag 65  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4854850 tatgagtgatgtggttggaactttagagcttgcgttgaaattggttatgagtggggag 4854907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University