View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16853_low_44 (Length: 213)

Name: NF16853_low_44
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16853_low_44
NF16853_low_44
[»] chr7 (2 HSPs)
chr7 (1-65)||(25264995-25265059)
chr7 (36-91)||(25264929-25264984)


Alignment Details
Target: chr7 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 25264995 - 25265059
Alignment:
Q  1 aatgggtaaaagaaataatcttgatctcaaggatatgaaatgggtgtgtgttgtagtgactgaca 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25264995 aatgggtaaaagaaataatcttgatctcaaggatatgaaatgggtgtgtgttgtagtgactgaca 25265059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 36 - 91
Target Start/End: Complemental strand, 25264984 - 25264929
Alignment:
Q  36 tgaaatgggtgtgtgttgtagtgactgacagaaggggtaaaagaaacaatcttgat 91  Q
    ||||||||||||||||||||||||||| | |||| |||| ||||||||||||||||    
T  25264984 tgaaatgggtgtgtgttgtagtgactggcggaagaggtagaagaaacaatcttgat 25264929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University