View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16853_low_37 (Length: 241)

Name: NF16853_low_37
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16853_low_37
NF16853_low_37
[»] chr1 (2 HSPs)
chr1 (112-194)||(27985981-27986063)
chr1 (188-235)||(27985902-27985949)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 112 - 194
Target Start/End: Complemental strand, 27986063 - 27985981
Alignment:
Q  112 aaaaggaactggggcaagatcttctagaatttgaagttcgaacttccactgcatattcccaaacactgcacaagagaagtttg 194  Q
    |||||||||| |||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||    
T  27986063 aaaaggaactagggcaagatcttctagaatttgaaattcgaacttccactacacattcccaaacactgcacaagagaagtttg 27985981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 27985949 - 27985902
Alignment:
Q  188 aagtttgtgtgagacatgagaatgacaatatatccaccagcaccacct 235  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||    
T  27985949 aagtttgtgtgagacatgagaatgacaatatatacaccagcaccacct 27985902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University