View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16851_low_9 (Length: 225)

Name: NF16851_low_9
Description: NF16851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16851_low_9
NF16851_low_9
[»] chr5 (1 HSPs)
chr5 (1-206)||(1016314-1016519)
[»] chr2 (2 HSPs)
chr2 (119-194)||(5175654-5175729)
chr2 (4-53)||(5175777-5175826)


Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 1016519 - 1016314
Alignment:
Q  1 tatgagacaatgacaaagagctaccacaaggcacccgccgcatttgctgtccttggtgttggtttggttgttgtctgtgatggagagaatgaaactgggt 100  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1016519 tatgagacaatgacaaagagctaccataaggcacccgccgcatttgctgtccttggtgttggtttggttgttgtctgtgatggagagaatgaaactgggt 1016420  T
Q  101 ggcggtggtgatgctgaaggggccatgttgatgtgttggatctaacaacaatgttgttgatagaacgttggagattgaggttttggttttggttcagtgt 200  Q
    ||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  1016419 ggcggtgatgatgttgaaggggccatgttgatgtgttgaatctaacaacaatgttgttgatagaacgttggagattgaggttttggttttggttctgtgt 1016320  T
Q  201 attaaa 206  Q
    | ||||    
T  1016319 actaaa 1016314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 119 - 194
Target Start/End: Complemental strand, 5175729 - 5175654
Alignment:
Q  119 ggggccatgttgatgtgttggatctaacaacaatgttgttgatagaacgttggagattgaggttttggttttggtt 194  Q
    |||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
T  5175729 ggggccatgttgatgtgttgaatctaacaacaacgttgttgatagaatgttggagattgaggttttggttttggtt 5175654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 53
Target Start/End: Complemental strand, 5175826 - 5175777
Alignment:
Q  4 gagacaatgacaaagagctaccacaaggcacccgccgcatttgctgtcct 53  Q
    ||||||| |||||||||||||||| ||| | ||||| |||||||||||||    
T  5175826 gagacaaggacaaagagctaccactaggtaaccgccacatttgctgtcct 5175777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University