View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1685-Insertion-1 (Length: 223)

Name: NF1685-Insertion-1
Description: NF1685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1685-Insertion-1
NF1685-Insertion-1
[»] chr8 (1 HSPs)
chr8 (7-223)||(33355329-33355547)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 33355547 - 33355329
Alignment:
Q  7 acacactctcttttttgtttccatcagttatgcatttaatgaaacagttcatcaacnnnnnnncacattctaatacttactagaaaaatccattggatca 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||| ||||||||||||| ||||||||||||||||    
T  33355547 acacactctcttttttgtttccatcagttatgcatttaatgaaacagttcatcaactttttttcacattataatacttactagcaaaatccattggatca 33355448  T
Q  107 tgttagttagcttaaatgttatgtagcattgat--attacatattaaagatgtgtctgatgtcaaacatgtgtaggcgctcaacaccaacatgatacaaa 204  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||    
T  33355447 tgttagttagcttaaatgttatgtagcattgatctattacatattaaagatgtgtctgatgtcaaacatgtgtaggcgttcaacatccacatgatacaaa 33355348  T
Q  205 cacatgtagttacttttaa 223  Q
    ||||||||||||| |||||    
T  33355347 cacatgtagttacatttaa 33355329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University