View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16841_high_11 (Length: 282)

Name: NF16841_high_11
Description: NF16841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16841_high_11
NF16841_high_11
[»] chr3 (2 HSPs)
chr3 (1-165)||(24522083-24522247)
chr3 (226-277)||(24521973-24522024)


Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 24522247 - 24522083
Alignment:
Q  1 acattgggtgtagaaattggtgatggaaaattgggaattggaaaagaattggaaaccctnnnnnnnnnnnnnnnnnnnnnnnnnaaccctaggaggaacg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                         ||||||||||||||||    
T  24522247 acattgggtgtagaaattggtgatggaaaattgggaattggaaaagaattggaaaccctagagagagaaagaaggagagagagaaaccctaggaggaacg 24522148  T
Q  101 tcggaggagggatctggtgcggaggagcgtcggacgcgtttcttctctgccgcgcctcccgatga 165  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24522147 tcggtggagggatctggtgcggaggagcgtcggacgcgtttcttctctgccgcgcctcccgatga 24522083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 226 - 277
Target Start/End: Complemental strand, 24522024 - 24521973
Alignment:
Q  226 agtacaagaagattcaatacattacaaatattaatttaatatattcttggac 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  24522024 agtacaagaagattcaatacattacaaatattaatttaatatattattggac 24521973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University