View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16840_low_44 (Length: 240)

Name: NF16840_low_44
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16840_low_44
NF16840_low_44
[»] chr1 (1 HSPs)
chr1 (1-132)||(504026-504156)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 504026 - 504156
Alignment:
Q  1 ttataaatggcacatagttgttttaaaacgatatgtaattaagaaatgaattaaaggatttaaataactggattatgttgctcgatgtatctctttcctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  504026 ttataaatggcacatagttgttttaaaacgatatgtaattaagaaatgaattaaaggatttaaataact-gattatgttgctcgatgtatctctttcctt 504124  T
Q  101 ccaataaaatgttcagtccttcatttttgttg 132  Q
    |||||||||||||||||||||||||| |||||    
T  504125 ccaataaaatgttcagtccttcatttatgttg 504156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University