View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16835_high_6 (Length: 327)

Name: NF16835_high_6
Description: NF16835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16835_high_6
NF16835_high_6
[»] chr2 (2 HSPs)
chr2 (186-308)||(4372009-4372131)
chr2 (8-64)||(4372134-4372190)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 186 - 308
Target Start/End: Complemental strand, 4372131 - 4372009
Alignment:
Q  186 cactgatcagtttttgatgtcataccctttgacttaaccgattgaaccttaccaaaatctggatcattctgaccgtcacgtttcacttcttgagaccatt 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  4372131 cactgatcagtttttgatgtcataccctttgacttaaccgattgaaccttaccaaaatctggatcattctgaccgtcacatttcacttcttgagaccatt 4372032  T
Q  286 cctcttgtaaatgatccacaaga 308  Q
    |||||||||||||||||||||||    
T  4372031 cctcttgtaaatgatccacaaga 4372009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 4372190 - 4372134
Alignment:
Q  8 attattctcattatcaatcacgagcctctcatacacccatgcatggtccttgaccca 64  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4372190 attattctcattatcaaccacgagcctctcatacacccatgcatggtccttgaccca 4372134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University