View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16832_low_47 (Length: 206)

Name: NF16832_low_47
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16832_low_47
NF16832_low_47
[»] chr1 (1 HSPs)
chr1 (1-189)||(5737215-5737403)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 5737215 - 5737403
Alignment:
Q  1 aaggtccatgacttcacacctctttaaagcaaagtaaaattgatagataaattggttgtaatctcaaatgtccaaaagcaatattgtgcatgcatcatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5737215 aaggtccatgacttcacacctctttaaagcaaagtaaaattgatagataaattggttgtaatctcaaatgtccaaaagcaatattgtgcatgcatcatca 5737314  T
Q  101 caacccacaacaggcaagctgcaggtatacattaacactttggctaaatttcacctaaaacggtacgaacttaaaatttggggacccta 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5737315 caacccacaacaggcaagctgcaggtatacattaacactttggctaaatttcacctaaaacggtacgaacttaaaatttggggacccta 5737403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University