View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16832_high_42 (Length: 212)

Name: NF16832_high_42
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16832_high_42
NF16832_high_42
[»] scaffold0014 (1 HSPs)
scaffold0014 (40-193)||(78517-78670)
[»] chr6 (1 HSPs)
chr6 (44-193)||(29483866-29484015)


Alignment Details
Target: scaffold0014 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 40 - 193
Target Start/End: Complemental strand, 78670 - 78517
Alignment:
Q  40 gatgtagatgaatcaaatggattaagttgtcattaggtgactagagaaacagaacaccgaactttcccttcaccgttgccgtgccagctaaatcacattg 139  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
T  78670 gatgtagatgaatcaaatggattaagttgtcattaggtgactagagaaacagaacaccgaactttcccttcacttttgccgtgccagctaaatcacattg 78571  T
Q  140 aacttattaatgattgtccatctagtttatgattgtccgtgcttgaattagttc 193  Q
    || ||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  78570 aaattattaatgattgtccatctaatttatgattgtccgtgcttgaattagttc 78517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 44 - 193
Target Start/End: Original strand, 29483866 - 29484015
Alignment:
Q  44 tagatgaatcaaatggattaagttgtcattaggtgactagagaaacagaacaccgaactttcccttcaccgttgccgtgccagctaaatcacattgaact 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||| ||||||||| |    
T  29483866 tagatgaatcaaatggattaagttgtcattaggtgactagagaaatagaacaccgaactttcccttcactgttaccgtgccagctaaaccacattgaaat 29483965  T
Q  144 tattaatgattgtccatctagtttatgattgtccgtgcttgaattagttc 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29483966 tattaatgattgtccatctagtttatgattgtccgtgcttgaattagttc 29484015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University