View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16829_low_15 (Length: 252)

Name: NF16829_low_15
Description: NF16829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16829_low_15
NF16829_low_15
[»] scaffold0095 (1 HSPs)
scaffold0095 (1-204)||(26822-27028)
[»] chr8 (1 HSPs)
chr8 (1-204)||(39402864-39403070)


Alignment Details
Target: scaffold0095 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: scaffold0095
Description:

Target: scaffold0095; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 27028 - 26822
Alignment:
Q  1 tatgtagctttctccggcgttcaaatggccggcgggggatccgatccgagttggagaacgttggagccgttgaaaagcatcggtggagtgccactgtttt 100  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| || |||||||||||  ||||||    
T  27028 tatgtagctttctccggctttcaaatggccggcgggggatccgatccgagttggagaacgttggagcctttggaaagtattggtggagtgccgttgtttt 26929  T
Q  101 cgaggcatcggaata---aagaggaggagccggtgaaggttcattccgggatcttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg 197  Q
    ||| || ||||||||   ||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  26928 cgacgcgtcggaataaggaagaggaggagccggtgaaggttcactccgggatgttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg 26829  T
Q  198 tttattt 204  Q
    |||||||    
T  26828 tttattt 26822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 39403070 - 39402864
Alignment:
Q  1 tatgtagctttctccggcgttcaaatggccggcgggggatccgatccgagttggagaacgttggagccgttgaaaagcatcggtggagtgccactgtttt 100  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| || |||||||||||  ||||||    
T  39403070 tatgtagctttctccggctttcaaatggccggcgggggatccgatccgagttggagaacgttggagcctttggaaagtattggtggagtgccgttgtttt 39402971  T
Q  101 cgaggcatcggaata---aagaggaggagccggtgaaggttcattccgggatcttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg 197  Q
    ||| || ||||||||   ||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  39402970 cgacgcgtcggaataaggaagaggaggagccggtgaaggttcactccgggatgttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg 39402871  T
Q  198 tttattt 204  Q
    |||||||    
T  39402870 tttattt 39402864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University