View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16829_high_13 (Length: 253)

Name: NF16829_high_13
Description: NF16829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16829_high_13
NF16829_high_13
[»] chr5 (1 HSPs)
chr5 (95-237)||(8218820-8218962)


Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 95 - 237
Target Start/End: Original strand, 8218820 - 8218962
Alignment:
Q  95 gtaaagctagcacttcaacaggcccctccgaataacaaatacttttcaattcctttttctctaaattctacaaaactgtgtttttccagtagaatataat 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  8218820 gtaaagctagcacttcaacaggcccctccgaataacaaatacttttcaatttctttttctctaaattctacaaaactgtgtttttccagtagaatataat 8218919  T
Q  195 tagtcattaaagtaaatcaactcaatccaattagtagcatatt 237  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
T  8218920 tagtcgttaaagtaaatcaactcaatccaattagtagcatatt 8218962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University