View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16828_high_17 (Length: 201)

Name: NF16828_high_17
Description: NF16828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16828_high_17
NF16828_high_17
[»] chr8 (2 HSPs)
chr8 (19-188)||(31908409-31908578)
chr8 (20-80)||(35986896-35986956)


Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 31908409 - 31908578
Alignment:
Q  19 aaaattcgaagataatttggatgaagcacttttagaagatgaatggaaccacatggagattatgtatcaaggtgaaaacaatgccctagtccccattgaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||    
T  31908409 aaaattcgaagataatttggatgaagcacttttagaagatgaatggaaccatgtggagattatgtatcaaggtgaaaacaatgccctagtccccattgaa 31908508  T
Q  119 agtggaatccatgtattcaaacagaagtgtatcacagatgatattcgattcaccgacccttgaagaataa 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  31908509 agtggaatccatgtattcaaacagaagtgtatcacagatgatattcgattcacggacccttgaagaataa 31908578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 35986896 - 35986956
Alignment:
Q  20 aaattcgaagataatttggatgaagcacttttagaagatgaatggaaccacatggagatta 80  Q
    |||||| ||| |||||||||||||| |||| ||||| |||||||||||||| | |||||||    
T  35986896 aaattcaaagctaatttggatgaagaacttgtagaaaatgaatggaaccacgttgagatta 35986956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University