View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16823_low_21 (Length: 316)

Name: NF16823_low_21
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16823_low_21
NF16823_low_21
[»] chr6 (2 HSPs)
chr6 (7-93)||(17426936-17427021)
chr6 (132-160)||(17427019-17427047)


Alignment Details
Target: chr6 (Bit Score: 67; Significance: 9e-30; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 17426936 - 17427021
Alignment:
Q  7 taaagataaaaccattcatcacttactttaggtgtttgaattccttaccactcagaccaaccactttgagatataattgaatttttc 93  Q
    |||||||||||||||||||| | |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17426936 taaagataaaaccattcatc-catgttttaggtgtttgaattccttaccactcagaccaaccactttgagatataattgaatttttc 17427021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 160
Target Start/End: Complemental strand, 17427047 - 17427019
Alignment:
Q  132 agaagaattgatttaatttaaatgaggaa 160  Q
    |||||||||||||||||||||||||||||    
T  17427047 agaagaattgatttaatttaaatgaggaa 17427019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University