View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16823_high_30 (Length: 250)

Name: NF16823_high_30
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16823_high_30
NF16823_high_30
[»] chr3 (1 HSPs)
chr3 (78-238)||(28775254-28775411)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 78 - 238
Target Start/End: Complemental strand, 28775411 - 28775254
Alignment:
Q  78 ttaaaagatctttggatgcatttgacctaaattaaattcatattttgatactacttctacttttgtccatcataagtatatgtctgttaggagaaatttc 177  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||    
T  28775411 ttaaaagacctttagatgcatttgacctaaattaaattcatattttgatactacttctacttttgtccat---aagtatatgtctgttaggagaaatttc 28775315  T
Q  178 tttgtctcttttacaagaccattcaaattacttgattaacgtacaacgagaagaccattca 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28775314 tttgtctcttttacaagaccattcaaattacttgattaacgtacaacgagaagaccattca 28775254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University