View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16821_low_21 (Length: 237)

Name: NF16821_low_21
Description: NF16821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16821_low_21
NF16821_low_21
[»] chr5 (1 HSPs)
chr5 (13-237)||(36833006-36833230)
[»] chr7 (1 HSPs)
chr7 (123-237)||(42068679-42068795)
[»] chr1 (1 HSPs)
chr1 (175-235)||(9982048-9982108)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 36833006 - 36833230
Alignment:
Q  13 tcatttttcatgcagctagaggacatgcatgattgggtgtccacgtcaacccttcatagtgatgggaccaaagggtgcaaaataattattgatattgaat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36833006 tcatttttcatgcagctagaggacatgcatgattgggtgtccacgtcaacccttcatagtgatgggaccaaagggtgcaaaataattattgatattgaat 36833105  T
Q  113 aggagcatatcaaaggttggagtcacctttggatcgagagtgattcgtagatagctatttcgaaatctcatgatttggttccttgggaccttcccaatcg 212  Q
      | ||||||||||||||||||||||||||| || || ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |    
T  36833106 ttgcgcatatcaaaggttggagtcacctttgaattgaaagtgattcgtagataactatttcaaaatctcatgatttggttccttgggaccttcccaattg 36833205  T
Q  213 ttggaacaattgctttgcctctcct 237  Q
    |||||||||||||||||||||||||    
T  36833206 ttggaacaattgctttgcctctcct 36833230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 237
Target Start/End: Original strand, 42068679 - 42068795
Alignment:
Q  123 caaaggttggagtcacctttggatcgagagtgattcgtagatagctatt--tcgaaatctcatgatttggttccttgggaccttcccaatcgttggaaca 220  Q
    ||||||||||||||  |||||||| |||||||||||   ||||||||||  |  |||| ||||||||||||  |||||||||||| ||||| || || ||    
T  42068679 caaaggttggagtcgtctttggattgagagtgattcaccgatagctattcattcaaatttcatgatttggtctcttgggaccttcgcaatcattagagca 42068778  T
Q  221 attgctttgcctctcct 237  Q
    |||| ||||||||||||    
T  42068779 attgttttgcctctcct 42068795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 235
Target Start/End: Complemental strand, 9982108 - 9982048
Alignment:
Q  175 aaatctcatgatttggttccttgggaccttcccaatcgttggaacaattgctttgcctctc 235  Q
    |||| ||||||| |||||||||||||||||| ||||| ||||| |||||||||||| ||||    
T  9982108 aaatatcatgatatggttccttgggaccttcgcaatcattggagcaattgctttgcttctc 9982048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University