View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1681_low_70 (Length: 228)

Name: NF1681_low_70
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1681_low_70
NF1681_low_70
[»] chr6 (1 HSPs)
chr6 (62-212)||(7328328-7328478)


Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 62 - 212
Target Start/End: Complemental strand, 7328478 - 7328328
Alignment:
Q  62 gtttgccaactattttaactgcatttattatggatctaaaaagagagaattgatacttcatcaattgattatgagatatttctgggctgctacactaatt 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7328478 gtttgccaactattttaactgcatttattatggatctaaaaagagagaattgatacttcatcaattgattatgagatatttctgggctgctacactaatt 7328379  T
Q  162 aattgctaccattaatccaatcaattgaaacttcaatacacacttatgttg 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7328378 aattgctaccattaatccaatcaattgaaacttcaatacacacttatgttg 7328328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University