View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16818_low_31 (Length: 227)

Name: NF16818_low_31
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16818_low_31
NF16818_low_31
[»] chr5 (1 HSPs)
chr5 (7-121)||(16272316-16272430)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 16272430 - 16272316
Alignment:
Q  7 ataccatagtgtctctcaacgacaaaaggtgaagtcttgggtcttcttttgtgctctcaagtgggtgagggacatggaacatcaacaagtcatctttgag 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16272430 ataccatagtgtctctcaacgacaaaaggtgaagtcttgggtcttcttttgtgctctcaagtgggtgagggacatggaacatcaacaagtcatctttgag 16272331  T
Q  107 gttgattgcaagata 121  Q
    |||||||||||||||    
T  16272330 gttgattgcaagata 16272316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University