View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16818_high_18 (Length: 272)

Name: NF16818_high_18
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16818_high_18
NF16818_high_18
[»] chr6 (1 HSPs)
chr6 (15-145)||(32343603-32343733)


Alignment Details
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 15 - 145
Target Start/End: Complemental strand, 32343733 - 32343603
Alignment:
Q  15 gagatgaagttcattttggttgtaggaatatgcttagtgttgggaatgtcccacaatgcatatggaaggaacttgaagaatgaaaaagaagatgtgaaaa 114  Q
    ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32343733 gagatgaagttcattttggttgtggggatatgcttagtgttgggaatgtcccacaatgcatatggaaggaacttgaagaatgaaaaagaagatgtgaaaa 32343634  T
Q  115 agccggaatggttctttgatacaccttctga 145  Q
    ||||||||||||||||||||||||| |||||    
T  32343633 agccggaatggttctttgatacaccatctga 32343603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University