View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16817_low_72 (Length: 241)

Name: NF16817_low_72
Description: NF16817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16817_low_72
NF16817_low_72
[»] chr5 (2 HSPs)
chr5 (37-152)||(12061670-12061781)
chr5 (207-241)||(12061582-12061616)


Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 37 - 152
Target Start/End: Complemental strand, 12061781 - 12061670
Alignment:
Q  37 taaaaatgtttgaaccttctttattnnnnnnntataatctaatatagattcaacgtaggttaaaccatagacctaagtcggtcattcaccattgttacat 136  Q
    |||||||||||||||||||||||||       |||||| ||||||||||||||||||||||||||||||||||||     || ||||| | |||||||||    
T  12061781 taaaaatgtttgaaccttctttattaaaaaaatataatttaatatagattcaacgtaggttaaaccatagaccta----tgttattcatcgttgttacat 12061686  T
Q  137 aaatatgaactgatcc 152  Q
    || |||||||||||||    
T  12061685 aattatgaactgatcc 12061670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 12061616 - 12061582
Alignment:
Q  207 tccactataacttgaattcgatttttaaaattcct 241  Q
    |||||||||||||||||||||||||||||||||||    
T  12061616 tccactataacttgaattcgatttttaaaattcct 12061582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University