View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16816_high_18 (Length: 274)

Name: NF16816_high_18
Description: NF16816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16816_high_18
NF16816_high_18
[»] chr4 (1 HSPs)
chr4 (182-242)||(25728574-25728634)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 182 - 242
Target Start/End: Complemental strand, 25728634 - 25728574
Alignment:
Q  182 gagttttgagactttatctaattctagcgagtcaccaaaattcaattccctcaaataaatt 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25728634 gagttttgagactttatctaattctagcgagtcaccaaaattcaattccctcaaataaatt 25728574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University