View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16815_low_80 (Length: 234)

Name: NF16815_low_80
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16815_low_80
NF16815_low_80
[»] chr8 (2 HSPs)
chr8 (19-152)||(28089438-28089571)
chr8 (174-226)||(43092756-43092808)


Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 19 - 152
Target Start/End: Original strand, 28089438 - 28089571
Alignment:
Q  19 cgaatagtgtcggagatgttggaccaagattgttaaggagcagtggaaagagaagggattggtgtttggatgaattgcttggacaacaagaaaatggagt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28089438 cgaatagtgtcggagatgttggaccaagattgttaaggagcagtggaaagagaagggattggtgtttggatgaattgcttggacaacaagaaaatggagt 28089537  T
Q  119 tgaatgccattgatgaaatatttcactaaattac 152  Q
    ||||||||||||||||||||||||||||||||||    
T  28089538 tgaatgccattgatgaaatatttcactaaattac 28089571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 43092756 - 43092808
Alignment:
Q  174 ttaataccagtaaaaattaacattggattagataatgtccgctctcaccctat 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  43092756 ttaataccagtaaaaattaacattggattagataatgtccgctctcacactat 43092808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University