View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16815_low_77 (Length: 239)

Name: NF16815_low_77
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16815_low_77
NF16815_low_77
[»] chr4 (2 HSPs)
chr4 (8-88)||(20359545-20359625)
chr4 (89-133)||(20361085-20361129)
[»] chr6 (1 HSPs)
chr6 (69-119)||(32194401-32194451)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 20359545 - 20359625
Alignment:
Q  8 agggttaggtggtggtatatgtgaattgctgattgtgattcattcatttcttccgtgtttcaatgtcgacgatggaattgc 88  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  20359545 agggtttggtggtggtatatgtgaattgctgattgtgattcattcattccttccgtgtttcaatgtcgacgatggaattgc 20359625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 89 - 133
Target Start/End: Original strand, 20361085 - 20361129
Alignment:
Q  89 gcgcaaccaaatactgcgaagaaagtgtgaagtcggacccggaac 133  Q
    |||||| ||||||||||||||||||||||||||||||||||||||    
T  20361085 gcgcaaacaaatactgcgaagaaagtgtgaagtcggacccggaac 20361129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 69 - 119
Target Start/End: Original strand, 32194401 - 32194451
Alignment:
Q  69 aatgtcgacgatggaattgcgcgcaaccaaatactgcgaagaaagtgtgaa 119  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||    
T  32194401 aatgtggacgatggaattgcgcgcaacgaaatactgcgaagaaagtgtgaa 32194451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University