View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16810_low_3 (Length: 258)

Name: NF16810_low_3
Description: NF16810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16810_low_3
NF16810_low_3
[»] chr4 (1 HSPs)
chr4 (12-239)||(7891538-7891765)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 7891538 - 7891765
Alignment:
Q  12 agaaacaatgttgaacaatcaaatttagttgagaaaatgatgatggaagttctagactcttggattgcagctgaatttctctgttctccgcttgtgagat 111  Q
    |||||| ||||||||| |||||||||| |||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||    
T  7891538 agaaaccatgttgaaccatcaaatttacttgagaaaatgatgatggaagttctacacgctttgattgcagctgaatttctctgttctccgcttgtgagat 7891637  T
Q  112 cgtgattgttgatgtaaacagcatatccagcttgtgtgagagcggaagagagatccaatgcaaaagatttaccaatgtctttgtcatggtaactcaaaaa 211  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  7891638 cgtgattgttgatataaacagcatatccagcttgtgtgagagcggaagagagatccaatgcaaaagatttaccaatgtatttgtcatggtaactcaaaaa 7891737  T
Q  212 cacatcgtacatccaaagatgatgagga 239  Q
    ||||||| ||||||||||||||||||||    
T  7891738 cacatcgaacatccaaagatgatgagga 7891765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University