View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16809_low_44 (Length: 211)

Name: NF16809_low_44
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16809_low_44
NF16809_low_44
[»] chr6 (1 HSPs)
chr6 (115-195)||(11961397-11961477)


Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 115 - 195
Target Start/End: Original strand, 11961397 - 11961477
Alignment:
Q  115 ccgggctcttgaatactactagcattgtcataccacttaatccatgtagcacgtctctcattctcccgtggactagcataa 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11961397 ccgggctcttgaatactactagcattgtcataccacttaatccatgtagcacgtctctcattctcccgtggactagcataa 11961477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University