View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16808_high_24 (Length: 237)

Name: NF16808_high_24
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16808_high_24
NF16808_high_24
[»] chr4 (1 HSPs)
chr4 (13-188)||(32650811-32650986)
[»] chr2 (2 HSPs)
chr2 (139-188)||(33854099-33854148)
chr2 (79-139)||(33854179-33854239)


Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 32650811 - 32650986
Alignment:
Q  13 gagatgaacgaatgaaagatttttgttttgagaaataaagagttgattnnnnnnngctaaccactataaatatcttctgtctccttcttcgattatgtgg 112  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||       |||||||||| |||||||||||||||||||||||| ||| |||||    
T  32650811 gagatgaacgaatgaaagatttttggtttgagaaataaagagttgattaaaaaaagctaaccactgtaaatatcttctgtctccttcttcaattgtgtgg 32650910  T
Q  113 atatggggttggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32650911 atatggggttggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta 32650986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 33854148 - 33854099
Alignment:
Q  139 aatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta 188  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||    
T  33854148 aatcaaagtggacgaaggtgatagaaattggagaagaatgaatggcagta 33854099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 33854239 - 33854179
Alignment:
Q  79 taaatatcttctgtctccttcttcgattatgtggatatggggttggagttgtggagaggaa 139  Q
    |||||||||| ||||||||||||||||| |||||||||||| |||||||| ||||||||||    
T  33854239 taaatatcttttgtctccttcttcgattgtgtggatatgggtttggagttatggagaggaa 33854179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University