View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16807_low_17 (Length: 249)

Name: NF16807_low_17
Description: NF16807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16807_low_17
NF16807_low_17
[»] chr2 (1 HSPs)
chr2 (1-241)||(17609439-17609679)
[»] chr3 (1 HSPs)
chr3 (168-236)||(48258332-48258400)


Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 17609679 - 17609439
Alignment:
Q  1 actgccgcaaaataaagattttagaggtctttgcagtggcatcaatattgcaaccgcagctgaatcagctgcattttccgctatatcaaggtttgcagac 100  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  17609679 actgcctcagaataaagattttagaggtctttgcagtggcatcaatattgcaaccgcagctgaatcagctgcattttccgcgatatcaaggtttgcagac 17609580  T
Q  101 cgttaccgcaatatagaaccacgagggaaagaacaaacattcatgttgttaatgaaaatatgaaaaactcacctgtcccctgctgagcatttcagacttt 200  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17609579 cgtgaccgcaatatagaaccacgagggaaagaacaaacattcatgttgttaatgaaaatatgaaaaactcacctgtcccctgctgagcatttcagacttt 17609480  T
Q  201 ttcaactttttcatggcatatatattaccggatttcatctc 241  Q
    |||||||||||||||||||||||||| ||||||||| ||||    
T  17609479 ttcaactttttcatggcatatatattgccggatttcttctc 17609439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 236
Target Start/End: Complemental strand, 48258400 - 48258332
Alignment:
Q  168 ctcacctgtcccctgctgagcatttcagactttttcaactttttcatggcatatatattaccggatttc 236  Q
    |||||||| || || |||||||||||||| || |||| ||||||||||||||| ||||| || ||||||    
T  48258400 ctcacctggcctctcctgagcatttcagatttcttcagctttttcatggcatagatatttccagatttc 48258332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University