View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16806_low_8 (Length: 285)

Name: NF16806_low_8
Description: NF16806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16806_low_8
NF16806_low_8
[»] chr3 (2 HSPs)
chr3 (189-244)||(55031686-55031741)
chr3 (132-190)||(55031770-55031828)
[»] chr2 (1 HSPs)
chr2 (194-244)||(37523763-37523813)


Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 189 - 244
Target Start/End: Complemental strand, 55031741 - 55031686
Alignment:
Q  189 tgacatttgactacatatcgtacacattatacatgacacatgatcacaaattaata 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55031741 tgacatttgactacatatcgtacacattatacatgacacatgatcacaaattaata 55031686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 55031828 - 55031770
Alignment:
Q  132 gaggatggctgtgtttgtaccgttcgccttttcgttttgttaatttaactagtgtcatg 190  Q
    ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||    
T  55031828 gaggatggctgtgtttgtaccgttcgcgttttagttttgttaatttaactagtgtcatg 55031770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 244
Target Start/End: Complemental strand, 37523813 - 37523763
Alignment:
Q  194 tttgactacatatcgtacacattatacatgacacatgatcacaaattaata 244  Q
    ||||||||||  |||| |||||| |||||||||||| ||||||||||||||    
T  37523813 tttgactacacgtcgtccacattctacatgacacataatcacaaattaata 37523763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University