View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16805_low_9 (Length: 290)

Name: NF16805_low_9
Description: NF16805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16805_low_9
NF16805_low_9
[»] chr8 (1 HSPs)
chr8 (116-274)||(40360641-40360799)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 116 - 274
Target Start/End: Original strand, 40360641 - 40360799
Alignment:
Q  116 cactgtccctttaatgtttccctcctctgttttggtctctgcctcaactttctcatttgaatcaaccactttctcttctcttagatcaatgtctttgtta 215  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40360641 cactgtcccttcaatatttccctcctctgttttggtctctgcctcaactttctcatttgaatcaaccactttctcttctcttagatcaatgtctttgtta 40360740  T
Q  216 atgttaatcttctcctccttctcctccttctcctctgtagttttgcattcggagttttc 274  Q
    ||||| |||||||||| ||||| ||||| |||||| |||||||||||||||||||||||    
T  40360741 atgttcatcttctccttcttcttctcctcctcctccgtagttttgcattcggagttttc 40360799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University