View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16804_high_34 (Length: 218)

Name: NF16804_high_34
Description: NF16804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16804_high_34
NF16804_high_34
[»] chr4 (1 HSPs)
chr4 (18-186)||(12855171-12855339)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 12855339 - 12855171
Alignment:
Q  18 aaaccctaaaaagtataaaagtgnnnnnnnnatgtaaaaaatttctttttggtttctttaactaatgatccgtaacactattagtatnnnnnnnncactg 117  Q
    |||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||    
T  12855339 aaaccctaaaaagtataaaagtgttttttttatgtaaaaaatttctttttggtttctttaactaatgatccgtaacactattagtataaaaaaaa-actg 12855241  T
Q  118 gtgtgatatca-nnnnnnnnaaagagtgatatcctttttcttggtaattactaattgagaaatatgtgac 186  Q
    |||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12855240 gtgtgatatcatttttttttaaagagtgatatcctttttcttggtaattactaattgagaaatatgtgac 12855171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University