View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16803_low_39 (Length: 294)

Name: NF16803_low_39
Description: NF16803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16803_low_39
NF16803_low_39
[»] chr3 (1 HSPs)
chr3 (48-278)||(32725475-32725705)


Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 48 - 278
Target Start/End: Complemental strand, 32725705 - 32725475
Alignment:
Q  48 ttgtggaaaggttcatggactcacttcatcattattcagcggtttttgattcattggaggctggttttccgatgcagaaccgggcccggactttggtgga 147  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32725705 ttgtggaaaggttcatggactcacttcatcattattcagcggtttttgattcattggaggctggttttccgatgcagaaccgggcccggactttggtgga 32725606  T
Q  148 gagggtattttttgggcctagaattgcaggctcgttgggccggatatatagaacgggtggtgaagaggagagaaggtcatggggggagtggttaggtgag 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32725605 gagggtattttttgggcctagaattgcaggctcgttgggccggatatatagaacgggtggtgaagaggagagaaggtcatggggggagtggttaggtgag 32725506  T
Q  248 gtagggtttaggggagttccggtgagctttg 278  Q
    |||||||||||||||||||||||||||||||    
T  32725505 gtagggtttaggggagttccggtgagctttg 32725475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University