View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16799_low_15 (Length: 240)

Name: NF16799_low_15
Description: NF16799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16799_low_15
NF16799_low_15
[»] chr4 (1 HSPs)
chr4 (14-218)||(56019988-56020192)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 218
Target Start/End: Complemental strand, 56020192 - 56019988
Alignment:
Q  14 tgaatcaaccgagagaatttatgcataaggttgaccctcttttgcaaggacacttccccaaccgaggtctgcgtcgtctgcttttaataattgatatgtg 113  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56020192 tgaatgaaccgagagaatttatgcataaggttgaccctcttttgcaaggacacttccccaaccgaggtctgcgtcgtctgcttttaataattgatatgtg 56020093  T
Q  114 tctccgggagaatccaagagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtctataaacatggg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56020092 tctccgggagaatccaagagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtctataaacatggg 56019993  T
Q  214 gtgcg 218  Q
     ||||    
T  56019992 ttgcg 56019988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University