View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16798_high_48 (Length: 257)

Name: NF16798_high_48
Description: NF16798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16798_high_48
NF16798_high_48
[»] chr8 (1 HSPs)
chr8 (28-204)||(36358028-36358204)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 28 - 204
Target Start/End: Original strand, 36358028 - 36358204
Alignment:
Q  28 aaatgaaaagacatggtacttggggcttcccaacaacacaatatgttgcacttgagaagaagaaaaacaccatccataacttagtcttatgatccatatc 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36358028 aaatgaaaagacatggtacttggggcttcccaacaacacaatatgttgcacttgagaagaagaaaaacaccatccataacttagtcttatgatccatatc 36358127  T
Q  128 nnnnnnnnnnnntgtcaaaagtttgttctgatccaaaatatttggaatccaagcacaagatttgcaggtgtagctaa 204  Q
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36358128 aaaaagaaaaaatgtcaaaagtttgttctgatccaaaatatttggaatccaagcacaagatttgcaggtgtagctaa 36358204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University