View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16797_low_25 (Length: 255)

Name: NF16797_low_25
Description: NF16797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16797_low_25
NF16797_low_25
[»] chr4 (3 HSPs)
chr4 (62-255)||(50074111-50074304)
chr4 (14-63)||(50074853-50074902)
chr4 (14-63)||(50068834-50068883)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 62 - 255
Target Start/End: Complemental strand, 50074304 - 50074111
Alignment:
Q  62 atctttgtatgcatgcaaatttgaatcctttnnnnnnngaattagtatttatataaaacaatctctgtatgcatatgcaatcttannnnnnnaaggaaat 161  Q
    |||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||| |||||||||||||||||||       ||||||||    
T  50074304 atctttgtatgcatgcaaatttgaatcctttaaaaaaagaattagtatttatataaaacaatctccgtatgcatatgcaatcttatttttttaaggaaat 50074205  T
Q  162 tgtatgcaggcaaatgtttatgatgatcatattagtataaaataacatatttaagcaacattttcttgccctagtttatctaacctccgtagat 255  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50074204 tgtatgcacgcaaatgtttatgatgatcatattagtataaaataacatatttaagcaacattttcttgccctagtttatctaacctccgtagat 50074111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 14 - 63
Target Start/End: Complemental strand, 50074902 - 50074853
Alignment:
Q  14 gagatgaagttgaaattcatatttaagtaaagtaattttataaaacttat 63  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50074902 gagatgaagttgaaattcatatttaagtaaagtaattttataaaacttat 50074853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 14 - 63
Target Start/End: Complemental strand, 50068883 - 50068834
Alignment:
Q  14 gagatgaagttgaaattcatatttaagtaaagtaattttataaaacttat 63  Q
    ||||||||||||||| ||||||||||||||||||||||||||||| ||||    
T  50068883 gagatgaagttgaaagtcatatttaagtaaagtaattttataaaatttat 50068834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University