View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16796_low_35 (Length: 234)

Name: NF16796_low_35
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16796_low_35
NF16796_low_35
[»] chr4 (1 HSPs)
chr4 (157-234)||(46751292-46751369)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 46751292 - 46751369
Alignment:
Q  157 agcatcaaacaaaatccaacaaggctttgggttcagttttgatgtgctatgtaatcagacatttgtttctaactgact 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46751292 agcatcaaacaaaatccaacaaggctttgggttcagttttgatgtgctatgtaatcagacatttgtttctaactgact 46751369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University