View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16796_low_26 (Length: 305)

Name: NF16796_low_26
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16796_low_26
NF16796_low_26
[»] chr2 (1 HSPs)
chr2 (18-305)||(1182430-1182717)


Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 1182430 - 1182717
Alignment:
Q  18 cataactcactctcacaaacactatcccttttttaccctctagccggacgtgtccaagacgccaccaccattaactgcaccgacgatggcgttttcttcg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  1182430 cataactcactctcacaaacactatcccttttttaccctctagccggacgtgtccaagacgccaccaccattaactgcaccgacgatggcgttttcttca 1182529  T
Q  118 tcgaatcacaaaccaccagcaatctctccgatatcctcacaaaccctaatttcaacacgcttgaatgcttcctcccaattacccaagaaaaacaaaacat 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  1182530 tcgaatcacaaaccaccagcaatctctccgatatcctcacaaaccctaatttcaacacgcttgaatgcttcctcccaactacccaagaaaaacaaaacat 1182629  T
Q  218 gctcttagtaatccgtttcactttgttcagttgtggttccaccgcaattaccgtgtcccttacacataagatcgttgactttaacaca 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1182630 gctcttagtaatccgtttcactttgttcagttgtggttccaccgcaattaccgtgtcccttacacataagatcgttgactttaacaca 1182717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University