View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16793_high_26 (Length: 268)

Name: NF16793_high_26
Description: NF16793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16793_high_26
NF16793_high_26
[»] chr2 (3 HSPs)
chr2 (12-197)||(375940-376125)
chr2 (54-119)||(44544811-44544876)
chr2 (54-119)||(44555453-44555518)
[»] chr8 (1 HSPs)
chr8 (220-268)||(55637-55685)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 12 - 197
Target Start/End: Original strand, 375940 - 376125
Alignment:
Q  12 tgaaatgaatatcgagtataaaacagcagttgtggaggatggtggaattcaggttggtcaattgttctttcatgatccagatggatatatgattgaaatg 111  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||    
T  375940 tgaaatgaatattgagtataaaacagcagttgtggaggatggtggaattaaggttgatcaattgttctttcatgatccagatggatatatgattgaaatg 376039  T
Q  112 tgcaattgccaaaatctccctgtgcttcctatttccacttgccctctaaagcagccaactaatcaagcaccagtacccttttatgg 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  376040 tgcaattgccaaaatctccctgtgcttcctatttccacttgccctctaaagcagccaactaatcaagcaccagtacccttttatgg 376125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 54 - 119
Target Start/End: Complemental strand, 44544876 - 44544811
Alignment:
Q  54 tggaattcaggttggtcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattg 119  Q
    ||||||||| || | ||||||||| |||||||| |||||||||| |||||||||||| ||||||||    
T  44544876 tggaattcaagtggatcaattgttttttcatgacccagatggatttatgattgaaatatgcaattg 44544811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 54 - 119
Target Start/End: Complemental strand, 44555518 - 44555453
Alignment:
Q  54 tggaattcaggttggtcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattg 119  Q
    ||||||||| || | ||||||||| |||||||| |||||||||| |||||||||||| ||||||||    
T  44555518 tggaattcaagtggatcaattgttttttcatgacccagatggatttatgattgaaatatgcaattg 44555453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 55685 - 55637
Alignment:
Q  220 ttatgaagataaatgatatggtgtatttaattagagagaatatataatt 268  Q
    ||||||||||||||||||||||| | |||||||||||||||||||||||    
T  55685 ttatgaagataaatgatatggtgcaattaattagagagaatatataatt 55637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University