View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16792_high_23 (Length: 237)

Name: NF16792_high_23
Description: NF16792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16792_high_23
NF16792_high_23
[»] chr3 (2 HSPs)
chr3 (1-98)||(51310606-51310703)
chr3 (149-222)||(51310748-51310821)


Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 51310606 - 51310703
Alignment:
Q  1 gagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgatagggacggggacg 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51310606 gagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgatagggacggggacg 51310703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 51310748 - 51310821
Alignment:
Q  149 aggcaacagactccatttccaaagaatgaggaacggttttgtgtgaagaatatagttttttggataagaatatg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51310748 aggcaacagactccatttccaaagaatgaggaacggttttgtgtgaagaatatagttttttggataagaatatg 51310821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University