View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16790_low_19 (Length: 272)

Name: NF16790_low_19
Description: NF16790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16790_low_19
NF16790_low_19
[»] chr6 (1 HSPs)
chr6 (15-207)||(24607478-24607670)


Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 24607478 - 24607670
Alignment:
Q  15 ctgtgatgcccaatagtggaaactgatgtatgacattggataacgccaaacaggctttgggatatcatgtgggagcctaaagtagccagagaccaacatg 114  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24607478 ctgtaatgcccaatagtggaaactgatgtatgacattggataacgccaaacaggctttgggatatcatgtgggagcctaaagtagccagagaccaacatg 24607577  T
Q  115 aagataccctgaaatttggaaagtagtaatcaaaaatataattaaaaggtatcataacaagtgtggattttgtaacaaaacacttggtaaatg 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24607578 aagataccctgaaatttggaaagtagtaatcaaaaatataattaaaaggtatcataacaagtgtggattttgtaacaaaacacttggtaaatg 24607670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University