View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16786_low_4 (Length: 210)

Name: NF16786_low_4
Description: NF16786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16786_low_4
NF16786_low_4
[»] chr8 (1 HSPs)
chr8 (1-192)||(5524971-5525162)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 5525162 - 5524971
Alignment:
Q  1 tgccagcgacgccgaggaggatgaggatgaagatgaggatgagaagaagccagcaacaaatggtgcaacaccagttacggttgttacggtaacggtgggt 100  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  5525162 tgccagcgacgccgaggaggatgaggacgaagatgaggatgagaagaagccagcaacaaatggtgcaacaccagttacggttgttacggtgacggtgggt 5525063  T
Q  101 ttgtggacggtaggttggccgggttgcaccgtagatttgcgcttttgtcgccgggaatgagggtttaacggcggtggctgcaccgccgttgg 192  Q
    |||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  5525062 ttgtggacggtaggttgggcgggtggcgccgtagatttgcgcttttgtcgccgggaatgagggtttaacggcggtggctgcaccaccgttgg 5524971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University