View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16785_low_7 (Length: 216)

Name: NF16785_low_7
Description: NF16785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16785_low_7
NF16785_low_7
[»] chr4 (1 HSPs)
chr4 (16-197)||(40399367-40399548)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 40399367 - 40399548
Alignment:
Q  16 aagaagaaggaatcggtcgaagttcgggaaccgagagtcgtgtccatcacaacaagaccgaagatctcatatcataacggatcatttaacgacttcactg 115  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  40399367 aagaagaaggaatcggtcgaagttcggcaaccgagagtcgtgtccatcacaacaagaccgaagatctcatatcataacggatcatttaacgatttcactg 40399466  T
Q  116 aggatgttgacctcattcccctttggtggaaaatatctctaatttagaattgttacaaagaaagtatttctctccaaaatca 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40399467 aggatgttgacctcattcccctttggtggaaaatatctctaatttagaattgttacaaagaaagtatttctctccaaaatca 40399548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University