View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16784_low_8 (Length: 311)

Name: NF16784_low_8
Description: NF16784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16784_low_8
NF16784_low_8
[»] chr4 (3 HSPs)
chr4 (217-294)||(47560802-47560879)
chr4 (24-91)||(47560978-47561045)
chr4 (162-206)||(47560863-47560907)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 217 - 294
Target Start/End: Complemental strand, 47560879 - 47560802
Alignment:
Q  217 cttcattagtctttcttatttgatagatctattctcaccgccattaattacaaactacaaacagatttcttgaccttt 294  Q
    |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||    
T  47560879 cttcattagtctttcttatttgatagatctatcctcaccgacattaattacaaactacaaacagatttcttgaccttt 47560802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 47561045 - 47560978
Alignment:
Q  24 aaacacgcacgcgtacacacccttcctgcctcagttttttcactttgaatttgaaaggtaatttcttg 91  Q
    |||||| | |||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
T  47561045 aaacacacgcgcgcacacacccttcttgcctcagtttttccactttgaatttgaaaggtaatttcttg 47560978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 47560907 - 47560863
Alignment:
Q  162 cgtcgtcgtcacagttgctttggacatccttcattagtctttctt 206  Q
    |||||||||||||||||||| ||||||||||||||||||||||||    
T  47560907 cgtcgtcgtcacagttgcttcggacatccttcattagtctttctt 47560863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University