View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16782_low_1 (Length: 454)

Name: NF16782_low_1
Description: NF16782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16782_low_1
NF16782_low_1
[»] chr6 (3 HSPs)
chr6 (173-270)||(2962132-2962233)
chr6 (62-108)||(2962956-2963002)
chr6 (173-211)||(2957632-2957670)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 270
Target Start/End: Complemental strand, 2962233 - 2962132
Alignment:
Q  173 ttttttctttagaaactaattcggccagctacatatttt----gtgagattaaaatctaacttcactccattttttaaattcatgtagagtgtgtctgat 268  Q
    |||||||||||||||||||||||||| ||||||||||||    |||||||||||||  ||||||||||||||||||||||||||||| ||||||| ||||    
T  2962233 ttttttctttagaaactaattcggcctgctacatattttatgtgtgagattaaaatgaaacttcactccattttttaaattcatgtatagtgtgtttgat 2962134  T
Q  269 gg 270  Q
    ||    
T  2962133 gg 2962132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 2963002 - 2962956
Alignment:
Q  62 tgaagtttgaactaaagagacagttggattttgtatgacctgctttt 108  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||    
T  2963002 tgaagtttgaactaaagagacagttggattttttatgacctgctttt 2962956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 211
Target Start/End: Complemental strand, 2957670 - 2957632
Alignment:
Q  173 ttttttctttagaaactaattcggccagctacatatttt 211  Q
    |||||||||||||||||||||||||| | ||||||||||    
T  2957670 ttttttctttagaaactaattcggcctgttacatatttt 2957632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University