View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16780_low_76 (Length: 223)

Name: NF16780_low_76
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16780_low_76
NF16780_low_76
[»] chr4 (2 HSPs)
chr4 (41-176)||(1163360-1163495)
chr4 (173-205)||(1163539-1163571)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 41 - 176
Target Start/End: Original strand, 1163360 - 1163495
Alignment:
Q  41 aaaaggacaacattttagagaagactttcaaagaggataccattttagaggataaaatgcaggataaccattgatacaaaaccaaactactaagattgtt 140  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1163360 aaaaggacaacattttatagaagactttcaaagaggataccattttagaggataaaatgcaggataaccattgatacaaaaccaaactactaagattgtt 1163459  T
Q  141 taatttaaagtccaaattgcatattacgctagtata 176  Q
    ||||||||||||||||||||||||||||||||||||    
T  1163460 taatttaaagtccaaattgcatattacgctagtata 1163495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 205
Target Start/End: Original strand, 1163539 - 1163571
Alignment:
Q  173 tataataaagacattgtcattagaaggagatgg 205  Q
    |||||||||||||||||||||||||||||||||    
T  1163539 tataataaagacattgtcattagaaggagatgg 1163571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University