View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16780_low_67 (Length: 240)

Name: NF16780_low_67
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16780_low_67
NF16780_low_67
[»] chr4 (2 HSPs)
chr4 (97-224)||(30718099-30718226)
chr4 (97-224)||(30894083-30894210)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 97 - 224
Target Start/End: Original strand, 30718099 - 30718226
Alignment:
Q  97 cctgattgagttgattcatggtgagatcaacggtgtggtgagagtgaagaagatgaatataatcttcgaggcagatcttctcgttctttgctggtcgctt 196  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  30718099 cctgattgagttgattcatggtgagatcaacggtgtggcgagagtgaagaagatgaatgtaatcttcgaggcagatcttctcgttctttgctggtcgctt 30718198  T
Q  197 cttcgtggagattgcgtgtggtaccatt 224  Q
    ||||||||||||||||||||||||||||    
T  30718199 cttcgtggagattgcgtgtggtaccatt 30718226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 97 - 224
Target Start/End: Complemental strand, 30894210 - 30894083
Alignment:
Q  97 cctgattgagttgattcatggtgagatcaacggtgtggtgagagtgaagaagatgaatataatcttcgaggcagatcttctcgttctttgctggtcgctt 196  Q
    ||||||||||||||||||| |||||||||  ||||| | ||||||||||||||||||| |||||||||||||||| ||| |||||||||||||  |||||    
T  30894210 cctgattgagttgattcatagtgagatcattggtgttgcgagagtgaagaagatgaatgtaatcttcgaggcagagcttttcgttctttgctgaacgctt 30894111  T
Q  197 cttcgtggagattgcgtgtggtaccatt 224  Q
    ||||| ||||||||||||||||||||||    
T  30894110 cttcgaggagattgcgtgtggtaccatt 30894083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University