View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16780_low_45 (Length: 293)

Name: NF16780_low_45
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16780_low_45
NF16780_low_45
[»] chr4 (2 HSPs)
chr4 (18-190)||(30781952-30782124)
chr4 (221-275)||(30782240-30782294)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 30781952 - 30782124
Alignment:
Q  18 tgaagacttggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaaccgtcccttttcttgcaaccattggtacaataagcgatgttcaa 117  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
T  30781952 tgaagactaggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaacggtcccttctcttgcaaccattggtacaataagcgatgttcaa 30782051  T
Q  118 agagagaactttctttgttgttgcttgatcttcttactaggttatgcttcttcatagttctatcttgttattg 190  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  30782052 agagagaattttctttgttgttgcttgatcttcttactaggttatgcttcttcattgttctatcttgttattg 30782124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 30782240 - 30782294
Alignment:
Q  221 gtcgggtctcctttcatgggcctttgtaacacggaattgttgcaactgactccgt 275  Q
    ||||||||||||||||||||  |||||||||||||||||||||||| ||||||||    
T  30782240 gtcgggtctcctttcatgggaatttgtaacacggaattgttgcaaccgactccgt 30782294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University